gfp expression cassette Search Results


gfp expression cassette  (GenScript corporation)
90
GenScript corporation gfp expression cassette
Gfp Expression Cassette, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp expression cassette/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gfp expression cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
aes containing a kanr cassette and the gfp gene optimised for its expression in mycobacteria (egfp)  (GenScript corporation)
90
GenScript corporation aes containing a kanr cassette and the gfp gene optimised for its expression in mycobacteria (egfp)
Aes Containing A Kanr Cassette And The Gfp Gene Optimised For Its Expression In Mycobacteria (Egfp), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aes containing a kanr cassette and the gfp gene optimised for its expression in mycobacteria (egfp)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
aes containing a kanr cassette and the gfp gene optimised for its expression in mycobacteria (egfp) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
lentivirus encoding a bi-cistronic gfp-cre expression cassette  (GenTarget)
90
GenTarget lentivirus encoding a bi-cistronic gfp-cre expression cassette
Lentivirus Encoding A Bi Cistronic Gfp Cre Expression Cassette, supplied by GenTarget, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus encoding a bi-cistronic gfp-cre expression cassette/product/GenTarget
Average 90 stars, based on 1 article reviews
lentivirus encoding a bi-cistronic gfp-cre expression cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
gfp expression cassette  (Promega)
90
Promega gfp expression cassette
( A ) Disruption of an untargeted gene by a <t>GFP</t> <t>expression</t> <t>cassette</t> fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.
Gfp Expression Cassette, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp expression cassette/product/Promega
Average 90 stars, based on 1 article reviews
gfp expression cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
90
Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
( A ) Disruption of an untargeted gene by a <t>GFP</t> <t>expression</t> <t>cassette</t> fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.
Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
lentiviral plasmids containing catd cdna and a gfp expression cassette  (Shanghai GenePharma)
90
Shanghai GenePharma lentiviral plasmids containing catd cdna and a gfp expression cassette
( A ) Disruption of an untargeted gene by a <t>GFP</t> <t>expression</t> <t>cassette</t> fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.
Lentiviral Plasmids Containing Catd Cdna And A Gfp Expression Cassette, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral plasmids containing catd cdna and a gfp expression cassette/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
lentiviral plasmids containing catd cdna and a gfp expression cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
gfp-neo expression cassette  (Quantum Biotechnologies Inc)
90
Quantum Biotechnologies Inc gfp-neo expression cassette
( A ) Disruption of an untargeted gene by a <t>GFP</t> <t>expression</t> <t>cassette</t> fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.
Gfp Neo Expression Cassette, supplied by Quantum Biotechnologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp-neo expression cassette/product/Quantum Biotechnologies Inc
Average 90 stars, based on 1 article reviews
gfp-neo expression cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Disruption of an untargeted gene by a GFP expression cassette fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.

Journal: Scientific Reports

Article Title: Non-canonical integration events in Pichia pastoris encountered during standard transformation analysed with genome sequencing

doi: 10.1038/srep38952

Figure Lengend Snippet: ( A ) Disruption of an untargeted gene by a GFP expression cassette fused to E. coli KRX DNA ( B ) Disruption of an untargeted gene by a re-integrated AOX1 locus. ( C ) Co-integration of E. coli KRX DNA in fusion with an expression cassette at the AOX1 locus.

Article Snippet: In brief, a linearized GFP expression cassette (purified with Wizard ® Plus SV Minipreps DNA Purification System, Promega, Madison, WI) was transformed into P. pastoris and targeted the AOX1 locus on chromosome 4 for replacement.

Techniques: Disruption, Expressing

( A ) After transformation the linear GFP expression cassette from pAHBgl-GFP moved to chromosome 4, where the AOX1 locus is situated. ( B ) Two distal homologous sequences of the cassette with the chromosomal AOX1 locus mediate a double cross-over recombination event ( C ) The cassette has replaced the AOX1 locus on chromosome 4 ( D ) The excised linear AOX1 locus moved to chromosome 2 ( E ) Potentially due to a DSB initiating the NHEJ pathway, the AOX1 locus is integrated into a random gene on chromosome 2 ( F ) The untargeted gene PP7435_Chr2-1130 was disrupted. While the AOX1 locus is still functional, the disruption of the untargeted gene likely led to the observed abnormal colony morphology in the case of JPS014.

Journal: Scientific Reports

Article Title: Non-canonical integration events in Pichia pastoris encountered during standard transformation analysed with genome sequencing

doi: 10.1038/srep38952

Figure Lengend Snippet: ( A ) After transformation the linear GFP expression cassette from pAHBgl-GFP moved to chromosome 4, where the AOX1 locus is situated. ( B ) Two distal homologous sequences of the cassette with the chromosomal AOX1 locus mediate a double cross-over recombination event ( C ) The cassette has replaced the AOX1 locus on chromosome 4 ( D ) The excised linear AOX1 locus moved to chromosome 2 ( E ) Potentially due to a DSB initiating the NHEJ pathway, the AOX1 locus is integrated into a random gene on chromosome 2 ( F ) The untargeted gene PP7435_Chr2-1130 was disrupted. While the AOX1 locus is still functional, the disruption of the untargeted gene likely led to the observed abnormal colony morphology in the case of JPS014.

Article Snippet: In brief, a linearized GFP expression cassette (purified with Wizard ® Plus SV Minipreps DNA Purification System, Promega, Madison, WI) was transformed into P. pastoris and targeted the AOX1 locus on chromosome 4 for replacement.

Techniques: Transformation Assay, Expressing, Functional Assay, Disruption